Prion Gene 5' DNA Untranslated Leader Sequences
Structure of overall vertebrate prion gene
Prion Gene 3' DNA Untranslated Trailer Sequences
Alignment of non-coding exon 1 and exon 2

Prion Gene 5' Upstream Prion DNA Sequences

Nucleotides upstream of the AUG initiation codon have been determined to variable lengths by different researchers. Here, 13 species are aligned in the area upstream of the start codon. Colors indicate intron/exon boundary when known; these are generally 10 base pairs upstream.
 
                    ttttgcagagcagtcatt ATG	human
                            ctttgtggct ATG	Mesocricetus auratus
ctgacgccttgttctt cattttgcag attagccatc ATG	Cricetulus sp.
ctgatgccttgttctt catttcacag atcagccatc ATG	Rattus norvegicus
            tcct cattttgcag atcagtcatc ATG	zitter rat*
ctgataccttgttcct cattttgcag atcagtcatc ATG	Mus musculus short inc
ctgataccttgttcct cattttgcag atcagtcatc ATG	Mus musculus
atgctgacaccctctt tattttgcag agaagtcatc ATG	Ovis aries
atgctgacaccctctt tattttgcag ataagtcatc ATG	Bos taurus
                  attttgcag agaagtcatc ATG	Capra hircus
                   ttttgcag agcagtcatt ATG	Homo sapiens
actgacagcctcctct ctctttccag gtcagctgtc ATG      rabbit
tttgttttgttttgtt ttgtttgcag ataagccatc ATG	Mustela sp*
attttcatgtcttttt ttttttccag atcacctacc ATG	Trichosurus vulpecula
actgccctaacagtgt gtgtccttat gcccgcagcc ATG	Gallus gallus

* intron/exon boundary assigned by sequence homlogy.

Overall structure of the mammalian prion gene:
speciesexonintronexonintronexon orf5' utrcds3' utr
sheep 51 2,422 98 14,032 4,027 10 771 3,247
n. rat 47+ 2,229 98 628 1996 10 765 1,221
The exon/intron structure is given in more detail below: Ovis aries 1..31412 mRNA join(5666..5717,8139..8236,22268..26295) exon 5666..5717 exon 8139..8236 exon 22268..26295 CDS 22278..23048 tagaatgttt atagctgatg ccactgctat acagtcattc attatgctgc agactttaag tgatttttac gtgggcattt gatgctgaca ccctctttat tttgcagaga agtcatc ATG ---------------- Bos taurus 1..280 intron 1..224 exon 225..280 CDS 235..280 gac ctagactgtt tatagctgat gccactgcta tgcagtcatt atgctacaga ctttaagtga tttttacatg ggcatatgat gctgacaccc tctttatttt gcagataagt catc ATG Bos taurus 1..3404 exon <803..855 intron 856..3297 exon 3298..3395 intron 3396..>3404 ---------------- Three-exon structure of the gene encoding the rat prion protein Virus Genes 12 (1), 15-20 (1996) Rattus norvegicus1..5404 exon 2832..2878 intron 2879..5108 exon 5109..5206 5'UTR join(2832..2878, 5109..5206, 629..638) intron <1..628 exon 629..2625 other possible ending bases (2627,2628)" CDS 639..1403 tcctaaagg agaagccaca ggggtctgac ttcacacatt tgttctgaag atgtctagga gcttcagcct gagtgccgga cactgatgcc ttgttcttca tttcacagat cagccatc ATG ---------------- Mesocricetus auratus 1..492 intron <1..177 5'UTR <178..>276 mRNA <178..>276 exon 178..276 intron 277..>492 ---------------- Mus musculus long inc 1..3508 exon 1151..1223 mRNA join(1151..1223,3411..>3508) exon 3411..3508 ---------------- Mus musculus short inc 1..933 mRNA 97..>871 CDS 107..871 ttgacgccat gactttcata catttgcttt gtagatagat gtcaaggacc ttcagcctaa atactgggca ctgatacctt gttcctcatt ttgcagatca gtcatc ATG ---------------- Mus musculus 1..933 mRNA 97..>871 CDS 107..871 ttgacgccat gactttcata catttgcttt gtagatagat gtcaaggacc ttcagcctaa atactgggca ctgatacctt gttcctcatt ttgcagatca gtcatc ATG ---------------- Mus musculus 1..337 allele <1.. > 337 intron <1..117 exon 118..>337 intron 216..>337 ---------------- Mus musculus1..420 allele <1..>337 misc_feature 180..186 AP-1 site" misc_feature 248..253 Sp1 misc_feature 280..285 Sp1 exon <328..358 intron 359..>420 ---------------- Capra hircus 1..810 intron 1..9 mRNA 10..810 sig_peptide 20..91 CDS 20..790 attttgcaga gaagtcatc ATG ---------------- Homo sapiens 1..2301 exon 9..>2301 CDS 19..756 ttttgcagag cagtcatt ATG ---------------- H.sapiens exon 1 1..220 repeat unit CCGCCC join(7..12,71..76,84..89,100..105) in 71-206 region 1 ggccggccgc ccgccgcggg ggcacagagt gtgcgccggc gcgccggcga attggtcccc 61 gccgcgacct ccgcccgcga gcgccgcccg ttcccttccc cgccccgcgt ccctccccgc 121 ctcggccccg cgcgtcgcct ccagtcgctg ccagtcgctg acagccgcgg cgccgcgagc 181 ttctcctctc ctcacgaccg aggcaggtaa acgcccgggg exon 2 ccgcccgcga gcgccgcccg ttcccttccc cgccccgcgt ccctccccgc ctcggccccg cgcgtcgcct ccagtcgctg ccagtcgctg acagccgcgg cgccgcgagc ttctcctctc ctcacgaccg aggcaggtaa acgccc ttttgcagag cagtcatt ATG ---------------- Trichosurus vulpecula 1..1363 intron <1..277 5'UTR 278..287 exon 278..>1363 CDS 288..1067 attaaaaatg acatatatgt gtcttaattg tgtttctttt ttcccctcct tttcctttag tggtttctaa ataaacccag aattttcatg tctttttttt tttccagatc acctacc ATG ---------------- zitter rat 1..888 CDS 25..789 tcctcatttt gcagatcagt catc ATG ---------------- Mustela sp." CDS 41..814 tcattttgtt ttgttttgtt ttgtttgcag ataagccatc ATG ---------------- Gallus gallus 1..969 intron <1..34 5'UTR 35..36 exon 2 35..>969 CDS 37..858 actgccctaa cagtgtgtgt ccttatgccc gcagcc ATG ---------------- Mesocricetus auratus 1..1918 mRNA <1..1918 CDS 11..733 ctttgtggct ATG ---------------- Cricetulus sp. 1..931 intron <1..116 exon 117..>890 CDS 127..891 t gactgtcacc catttgttct gcaaaaaatg tcaagtggct tcagcctgcg tgctggacag tgttgtgttg ttggagtata ctgacgcctt gttcttcatt ttgcagatta gccatc ATG ---------------- caggggcccaggtgtggcagacaggtccaggctgtgatgctgccgtcacggcactgagcggctttagcatcggtccaggccactgacagcctcctctctctttccaggtcagctgtc ATG rabbit

Prion Gene 3' DNA Sequences

Gapped and aligned 3' non-coding prion DNA:


ttc ctg ata gtg gga tga ---ggaaggtcttcctgttttcaccatctttctaatctttttccagcttgagggaggcggtatccacctgcagcccttt	human
 F   L   I   V   G   st
ctc ctg ata gtg gga tga ---ggatggccttcccattctctccatcgtcttcaccttttac-aggttgggggagggggtgtctacctacagccctgta  mink
 F   L   I   V   G   st
ttt ctc ata gta gga tag ---gggcaaccttcctgttttcattatcttcttaatctttgcc-aggttgggggagggagtgtctacctgcagccc	sheep
 F   L   I   V   G   st
ttt ctc ata gta gga tag ---gggcaaccttcctgttttcattatcttcttaatctttacc-aggttgggggagggagtatctacctgcagccc	bovine
 F   L   I   V   G   st
ttc ctg atc gtg gga tga ----ggaggccttcctgcttgttccttctcatt-ctcgtggtctaggctgggggaggggttacccacctgtagctct	Z rat
 F   L   I   V   G   st
ttc ctg atc gtg gga tga ----ggaggccttcctgcttgttccttctcatt-ctcgtggtctaggctgggggaggggttacccacctgtagctct	N rat
 F   L   I   V   G   st
ttc ctg atc gtg gga tga ---gggaggccttcctgcttgttccttcgcatttctcgtggtctaggctgggggaggggttatcc             mouse,short incubation
 F   L   I   V   G   st
ttc ctg atg gtg gga tga ---aggaagcctccctgcttgtacttcctcgtt-cttgtggtctaggctgggggaggggttatccaccgtagctctt	arm.hamst
 F   L   M   V   G   st
ttc ctg ata gtg gga tga tgagggaagcctccctgcttgtacttcctcgtt-cttgtgc                                         hamster
 F   L   I   V   G   st
ttc ctg atc gtg gga tga ---gggaggcctccccgcctgcgccgtctccatccgtcctgcc	                                 rabbit
 F   L   I   V   G   st
ttc ctg att gtg agc taa ----gaag-ccttccgatgtttactctctcaatgtttattctcttaatctttgcagagaaggaaatccttcagtctgc	oppossum
 F   L   I   V   S   st
ttt gcc atg cac tga     --tgggatgccgtgccccggccctgtggcagtgagatgacatcgtgtccccgtgcccacccatggggtgttcctt	chicken
 F   A   M   H   st  



Raw sequences available:
-----------------------------
ttt ctc ata gta gga tag gggcaaccttcctgttttcattatcttcttaatctttgccaggttgggggagggagtgtctacctgcagccc  Ovis aries
 F   L   I   V   G   st
 tgtagtggtg gtgtctcatt tcttgcttct ctcttgttacctgtataata atacccttgg cgcttacagc actgggaaat gacaagcaga catgagatgctgtttattca agtcccatta gctcagtatt ctaatgtccc atcttagcag tgattttgta gcaattttct catttgtttc aagaacacct gactacattt ccctttggga atagcatttc tgccaagtct ggaaggaggc cacataatat tcattcaaaa aaacaaaact ggaaatccttagttcataga cccagggtcc accctgttga gagcatgtgt cctgtgtctg cagagaactataaaggatat tctgcatttt gcaggttaca tttgcaggta acacagccat ctattgcatc 


ttc ctg atc gtg gga tga ggaggccttcctgcttgttccttctcattctcgtggtctaggctgggggaggggttacccacctgtagctctttcaat  Zitter rat
 F   L   I   V   G   st
tgaggtggtgtctcattcttg

ttc ctg atc gtg gga tga ggaggccttcctgcttgttccttctcattctcgtggt     Rattus norveg
ctaggctggg ggaggggtta cccacctgta gctctttcaa ttgaggtggt gtctcattct
tgcttctctt tgtcccccat aggctaatac ccttggcagt gatgggtctg gggaaatgta
cagtagacca gatgctattc gcttcagcgt cctttgattg agtccatcat gggccagggt
taacaccagg ccagtaagaa tataacacca aataactgct ggctagtcag ggctttgttt
tggtctactg agtaaatact gtgtaacccc tgaattgtac ccagaggaca tggtgacaga

ttc ctg atg gtg gga tga aggaagcctccctgcttgtacttcctcgttcttgtggtctaggctgggggag gggttatcca ccgtagctct M auratus
 F   L   M   V   G   st
 
tttaattgag gtggtgtctc attcctgctt ctctttgtcc cccataggct aatgcccttg
gcactagtgg gccctgggaa tgtacagtag accagatgct attcgatcca gagcctttga
attgagtcca tcacgggcca gcactaacac caggcctatc tgaatataac agcaagtaat
ggctggctag tcagggcttt gttttggtct agtgagtaaa tactgatgtg accctctgac
ttccacacag agtacgcagt gacagacaca cctaactgtt aaaataggcg aagggttcta
cagccaaaga agtcactgtt tggcatggtc cctaagaaac agcctcccat ttgggatatt ....

ttc ctg atc gtg gga tga gggaggccttcctgcttgttccttcgcatttctcgtggtctaggctgggggaggggttatcc mouse, short inc.
 F   L   I   V   G   st
     
ttc ctg atc gtg gga tga gggaggcctccccgcctgcgccgtctccatccgtcctgcc  Oryctolagus cuniculus
 F   L   I   V   G   st

ttc ctg att gtg agc taa gaagccttccgatgtttactctctcaatgtttattctcttaatctttgcagagaaggaaatccttcagtctgc T. vulpecula
aagggcagcc caaatagcag cagtttttca tttctatgtt cgtccatcac ccataggtta
aggcccttat cactcatgag ccctgggaaa tgtacagtag atcccagagg cccggccacc
gctctcctcc aaaccatttt gatcatgcgt ctgtcagatc aatgccacct ttggcagtat
cctttctgag ggagatcatt gggtaacttc tggtccatct aga   Trichosurus vulpecula

ctc ctg ata gtg gga tga ggatggccttcccattctctccatcgtcttcaccttttacaggttgggggagggggtgtctacctacagccctgta mink gtggtggtgtctcattcctg cttctcttta tcacccatag gctaatcccc ttggccctga tggccctggg
aaatgtagag cagacccagg atgctattta ttcaagcccc catgtgttgg agtccttcag
gggccaatgc tagtgcaggg ctgagaataa cagcaaatca tcattggttg acctagggct
gcttttttgt tgttgttgtc tagtgcagct gaccgaggct aaaacaattc tcaaaacagt
tttcaaatac ctttgcctgg aaacctctgg ctcctgctgc agctagagct cagtacatta...  

ttc ctg ata gtg gga tga ggaaggtcttcctgttttcaccatctttctaatctttttccagcttgagggaggcggtatccacctgcagcccttt human tagtggtggtgtctcactct ttcttctctc tttgtcccgg ataggctaat caataccctt ggcactgatgggcactggaa aacatagagt agacctgaga tgctggtcaa gccccctttg attgagttca
     1021 tcatgagccg ttgctaatgc caggccagta aaagtataac agcaaataac cattggttaa
     1081 tctggactta tttttggact tagtgcaaca ggttgaggct aaaacaaatc tcagaacagt
     1141 ctgaaatacc tttgcctgga tacctctggc tccttcagca gctagagctc agtatactaa
     1201 tgccctatct tagtagagat ttcatagcta tttagagata ttttccattt taagaaaacc
     1261 cgacaacatt tctgccaggt ttgttaggag gccacatgat acttattcaa aaaaatccta
     1321 gagattctta gctcttggga tgcaggctca gcccgctgga gcatgagctc tgtgtgtacc
     1381 gagaactggg gtgatgtttt acttttcaca gtatgggcta cacagcagct gttcaacaag...   human PID:g220016

ttt ctc ata gta gga tag gggcaaccttcctgttttcattatcttcttaatctttaccaggttgggggagggagtatctacc bovine
tgcagccccg tagtggtggt gtctcatttc gtgcttctct ctttgttacc tgtatgctaa
tacccttggc gcttatagca ctgggaaatg aagagcagac atgagatgct gtttattcaa
gtcccgttag ctcagtatgc taatgcccca tcttagcagt gattttgtag caattttctc
atttgtttca agaacacgtg actacatttc ccttttggaa tagcatttct gccaagtctg
gaaggaggcc acataatatt cattcaaaaa aacaaaccgg aaatccttag ttcatagacc
cagggtccac ctggttgaga gcttgtgtcc tgtgtctgca gagaactata aaggatattc
tgcattttgc aggttacatt tgcaggtaac acagccagct attgcatcaa gaatggatat
tcatgcaacc tttgacttat gggtagagga cattttcaca aggaatgaac ataatacgaa
aggcttctga gactaaaaaa ttccaacata tgggagaggt gcccttggtg gcagccttcc...  bovine PID:g217594


ttt gcc atg cac tga tgg gatgccgtgccccggccctgtggcagtgagatgacatcgtgtccccgtgcccacccatggggtgttccttgtcc chicken
tcgct tttgtccatctttggtgaagatgtccccc    chicken

ttc ctg ata gtg gga tga tga gggaagcctccctgcttgtacttcctcgttcttgtg c  Cricetulus sp.

--------------------------

Alignment of Non-coding Exon 1 and Exon 2

gcgttgtcagagcagcagacggagtctgagcgtcgcgtcggtggcag Nrat exon 1 tcccccgcgttgtcggatcagcagaccgattctgggcgctgcgtcgcatcggtggcag mouse exon 1 ccagtcgctgacagccgcagagctgagagcgtcttctctctcgcagaagcag cow exon 1 tgccagtcgctgacagccgcggcgccgcgagcttctcctctcctcacgaccgaggcag human exon 1 ggcgtccgagcagcagaccgagaaggcacatcgagtccactcgtcgcgtcggtggcag M.auratus exon 1 gactcctgaatatattccaaaactgaacaatttcaactgagctgaagtactctgtttttctagaggtaccagttcagtttagga-gagtcacagcaga-tc M.auratus exon 2 gactcctgaatatatttcaaaactgaaccatttcaacccaactgaagtattctgccttcttagcggtaccagtccggtttagga-gagcca-agccgact N rat exon 2 gactcctgagtatatttcagaactgaaccatttcaaccgagctgaagcattctgccttcctagtggtaccagtccaatttagga-gagcca-agcagactg mouse exon 2 gacttctgaatatatttgaaaactgaacagtttcaaccaagccgaagcat-ctgtcttcccagagacacaaatccaacttgagctgaatcacagcaga-tgtaggtacc cow exon 2 gacttctgaatatatttgaaaactgaacagtttcaaccaagctgaagcat-ctgtcttcccagagacacagatccaacttgagctgaatcacagcaga-t sheep exon 2