Known point variations in human prion coding region
Predictions of new human point mutations from CpG effect
Predictions of BSE-causing mutations from CpG effect
Normal prion function: clue from adjacent genes?
Survival time of sheep with scrapie depends on prion genotype
Amino acid polymorphisms of prions in Japanese and Dutch sheep
Alignment of sheep and human prion protein
Known cow polymorphisms don't affect course of BSE
(A graphic display is also available, compiled by P Bamborough and FE Cohen.)
"The fifth base in human DNA, 5-methylcytosine, is inherently mutagenic. This has led to marked changes in the distribution of the CpG methyl acceptor site and an 80% depletion in its frequency of occurrence in vertebrate DNA. The coding regions of many genes contain CpGs which are methylated in sperm and serve as hot spots for mutation in human genetic diseases. Fully 30-40% of all human germline point mutations are thought to be methylation-induced even though the CpG dinucleotide is under-represented and efficient cellular repair systems exist." [Bioessays 1992 Jan;14(1):33-36]
I looked at the existing set of 19 point mutations and overall occurence of CpG dinucleotides in the human prion gene. Basically, 6/19 of the point mutations are of this type, including all three high frequency ones, E200K, D178N, and P102L. In other words, practically all cases of familial CJD arise from this effect. (The repeat region is a hotspot of a different kind: for replication slippage.)
However, there were 21 CpG in the human gene. Each can go either of two ways, to TpG or CpA, after deamination. This gives 42 possibilities. Of these, 6 are known to occur, 15 are silent third position and unlikely to be detected except in control screening, 11 involve a mild change of amino acid, and 10 a non-conservative change. I have these tabulated, along with their 3D nmr location, at http://mad-cow.org/~tom/chromo.html#predictions . It would be most interesting to see to what extent phyllogenetic variation and alleles noted in other mammals might arise from this same mechanism.
I haven't seen a careful tabulation of how many separate events it took to give rise to the present set of known families, but after discounting for founder effects, I would estimate a couple hundred distinct mutational events. What will the situation look like after the data set reaches a couple of thousand or tens or thousands? It is a no-brainer to predict that the 10+11=21 new CpG mutations will be disproportionately represented. Beyond that, if the screen is CJD-causative, are some of these more likely to show up than others?
Hard to say. We have no explanation for why any of the known mutations give rise to disease [lod sense], though a case could be made for many that they give rise to over-production by not being exportable. There is no evidence now that a point mutation earlier than 102 could qualify; this accounts for half of the CpG candidates. On the other hand, there are 8 of the form R156H, R156C, and D202N in key secondary structures that are not unlike known mutations R208H and D178N.
A couple of these instances have been noticed in various reviews in years past but I am not aware of previous predictions of specific mutations that might be expected.
A lot of things are missed when a panel [of what should be standard tests] is never ordered. The CpG procedure is best implemented as a Web window that returns a table sorted by liklihood of functional disruption (rough opposite of a PAM matrix). How hard is it to run the test on all known human genes and their mutations when it is all sitting there at the OMIM database? Have to wonder if there exist general second order patterns beyond CpG. (Codon 129 and 219 are probably drift effects at the population level, not high frequency independent mutations.)
Note that the CpG scenario very much influences the structural interpretation of these substitutions. That is,leucine at 102, asparagine at 178, or lysine at 200 are not necessarily among the worst of the 19 substitutions that could occur, nor necessarily even the worst that could occur via a single nucleotide change: 102S, 102T, 102A, 102Q, 102R; D178H, D178Y, D178G, D178A, D178V; E200Q, E200-, E200G, E200A E200V. I have not see any alternative-substitution transgenic variants or nmr, so we don't know if L, N, and K specifically affect the conformational conversion process or exportability, as compared to a random substitution there.
Instead, P102L, D178N and E200K are merely substitutions that occur at high frequency under CpG, with perhaps the prion protein additionally more structurally or interactionally vulnerable to change (relative to the other 18 CpG codons) at 102, 178, and 200. Some of the 21 "missing" CpG changes could be at low-significance codons or only impair normal function. So for unobserved familial CJD, I would add these other substitutions to the list of predictions at rare levels.
In contrast, if there is no rate enhancement mechanism, the 9 causative non-CpG codons could be especially sensitive and the particular substitutions among the worst of the accessible choices: P105L, A117V, (N171S), V180I, T183A, F198S, V210I, Q217R, M232R. Of these, 6 are second codon position, 8 are transitions, 5 are both, so the data is weighted towards conservative change and generic mutational frequency, ie, towards positional sensitivity but not value.
It is hard to believe that the Y145- transversion is the only terminator that could cause disease. All in all, we are back to the original concept of severe non-saturation of familial CJD (inadequate screening).
2. These observations support an accompaning call for an international repository of DNA [and cell lines and frozen tissue] samples from CJD (and dementia) victims worldwide and an efficient central program for really studying these. I understand that Gibbs may be lining up something like this. Today we are looking at structure/function in the coding region and florid plaques; tomorrow it is up-regulations or alternative splicing in the promoter region [like in hamster] and who knows what.
The screening effort has not been commensurate with the plausible dimensions of nvCJD. A single lab in Sweden looked at 220,000 samples for another disorder. In one year. I don't see where anyone has looked systematically at the promoter regions in nvCJD or sporadic CJD. The upstream exons and intron junctions are so small and what's so hard about ordering a commercial primer? Why start a species sequence with the CDS when for another 30 bases you get the exon junction? How long does it take to run a couple of sequencing gels on 25 nvCJD samples? (I don't suggest sequencing entire introns here.)
We can't even begin to recognize promoter polymorphisms in CJD without baseline data. Meanwhile, the Alzheimer researchers are going on and on about very high-risk APOE -491A /epsilon 4 double mutants [Nat.Gen. 18:69 98], that is, mild up-regulation coupled with a susceptibility allele. This would make some sense for observed early onset of nvCJD: over-production via up-regulation in a higher exposure group with met/met susceptiblity.
The families are telling me over and over that they cannot even get the CDS from their CJD relative sequenced. Instead, the labs take a quick swing at the 178-200 region because of the restriction endonucleases they had on the shelf. Then they write a paper about how D178N and E200K are the most common mutations! Which they may well be. But when the penetrance is only 60-80% within a given family, it is time to sequence control regions.
We have to work with what we are given for in vivo with humans -- and make the most of it.
>Puckett-Hood human prion CDS sequence X83416 missing one repeat:
atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggca
gccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggcagcctcatggtggtggctgggggcagcctcatggtg
gtggctgggggcagccccatggtggtggctggggtcaaggaggtggcacccacagtcagtggaacaagccgagtaagccaaaaaccaacatgaagcacatggctg
gtgctgcagcagctggggcagtggtggggggccttggcggctacatgctgggaagtgccatgagcaggcccatcatacatttcggcagtgactatgaggaccgcta
ctatcgtgaaaacatgcaccgttaccccaaccaagtgtactacaggcccatggatgagtacagcaaccagaacaactttgtgcacgactgcgtcaatatcacaatc
aagcagcacacggtcaccacaaccaccaagggggagaacttcaccgagaccgacgttaagatgatggagcgcgtggttgagcagatgtgtatcacccagtacgag
agggaatctcaggcctattaccagagaggatcgagcatggtcctcttctcctctccacctgtgatcctcctgatctctttcctcatcttcctgatagtgggatga
However, a certain subset of these is quite worrisome: those CpG changes in bovine DNA that give rise to an amino acid substitution that, had they occured in human DNA in the homologous position, would suffice to cause CJD. It turns out that bovine and human sequences are similar enough that two known human CJD hotspot mutations are applicable to bovines: E200K and R208H.
Because prion genes are very slowly evolving, only miniscule differences are found in comparing human and bovine sequence threaded the known mouse and hamster nmr structures: this supports but does not prove that the consequences of the same mutations are similar. I predict that the most immediate concern for 'familial' BSE will arise from long insertional repeats and E200K.
The table below shows normal bovine in the first row with blue highlighting for residues where homologous changes in humans is associated with CJD. The second row shows in red the effect of C to T changes from the CpG effect, the third row the effect of G to A. Where blue and red align, I predict the change is causative for BSE. (Other sites are not ruled out by any means, simply not supported.) E200K is a very high frequency allele in familial CJD.
By analysis of interstitial 20p deletions, Schnittger et al. (1992) demonstrated the
following order of loci: pter--PRNP--SCG1 (118920)--BMP2A
(112261)--PAX1 (167411)--cen. Puckett et al. (1991) identified 5-prime of
the PRNP gene a RFLP that has a high degree of heterozygosity, which might serve as a
useful marker for the pter-p12 region of chromosome 20.
The structural gene for mouse prion (Prn-p) has been mapped to mouse chromosome 2. A
second murine locus, Prn-i, which is closely linked to Prn-p, determines the length
of the incubation period for scrapie in mice (Carlson et al., 1986). Yet another gene
controlling scrapie incubation times, symbolized Pid-1, is located on mouse
chromosome 17.
At least 8 paired box genes containing a paired box homologous protein domain have been
identified in the murine gene family and numbered Pax-1 through Pax-8. The mouse Pax-1
gene encodes a sequence-specific DNA binding-protein with transcriptional activating
properties (Deutsch et al., 1988; Chalepakis et al., 1991). The expression pattern of Pax-1
during mouse embryogenesis indicates that it may play an important role in the development
of the vertebral column. The autosomal recessive mutation 'undulated' (un) in the mouse
exhibits vertebral anomalies along the entire rostrocaudal axis and is associated with a point
mutation (G-to-A transition) at position 15 leading to a gly-to-ser replacement in a highly
conserved region of the paired box of Pax-1.
The mouse Pax-1 gene was mapped by linkage
analysis to distal mouse chromosome 2 in close proximity to 'undulated,' between the
beta-2-microglobulin and 'agouti' loci. This segment of mouse chromosome 2 exhibits
homology to human chromosome 20. Segmental trisomy (Francke, 1977) and monosomy
(Schnittger et al., 1989; Anad et al., 1990) for chromosome 20p is associated with anomalies
of intervertebral discs. Schnittger et al. (1992) demonstrated that the human PAX1 locus is
situated on 20p. The map position of PAX1 after fluorescence in situ hybridization FL-pter
value of 0.34 +/- 0.04 corresponds to band p11.2. (FL-pter = fractional length-pter
(Lichter et al., 1990).) The mean FL-pter value for the centromere of the same chromosome
20 identified by Q-banding was 0.46 +/- 0.04. By PCR analysis in somatic cell hybrids, Pilz
et al. (1993) confirmed the assignment of the PAX1 gene to chromosome 20. By analysis of
somatic cell hybrids and by fluorescence in situ hybridization, Stapleton et al. (1993)
mapped PAX1 to 20p11.
Helwig et al. (1995) reported that mice who are doubly heterozygous for the mutants
'undulated' and 'Patch' have a phenotype reminiscent of an extreme form of spina bifida occulta
in humans (see 182940). The unexpected phenotype in double-mutant and not single-mutant
mice showed that novel congenital anomalies such as spina bifida can result from interaction
between products of independently segregating loci. This is an example of digenic inheritance.
(The 'undulated' mutation is sited in the Pax1 gene in mice, and the 'Patch' mutation is
associated with deletion of the mouse Pdgfra gene (PGDFRA; 173490).)
Predictions from the CpG effect
24Jan 98 webmaster
Recall that:
CpG mutations in bovines yielding known CJD alleles
4 Feb 98 Webmaster
Recalling that the CpG effect occurs across vertebrates, these might be expected to cause hotspots for mutations in cows. There has always been a concern about a steady background of one per million incidence of TSE in any mammal (Gibbs Principle). While the the bovine prion gene has its share of CpG occurences, the effect of hotspot changes at these is in general unpredictable.
Normal Prion Function: clue from adjacent genes?
Tools: Human Gene Database: Cardiff ...
Human Genome Map ...
Human Genome Project ... Genome Database accession# GDB:120720 ...
Gene Bank ... Medline
Sequence variation in intron of prion
protein gene, crucial for complete
diagnostic strategies
Palmer MS; van Leeven RH; Mahal SP; Campbell TA; Humphreys CB; Collinge J
Hum Mutat 7: 280-1 (1996)
Mapping of prion gene on chromosome 20:
The human gene for prion-related protein has been mapped to 20p12-pter by a
combination of somatic cell hybridization and in situ hybridization (Sparkes et al.,
1986) and by spot blotting of DNA from sorted chromosomes (Liao et al., 1986).
Robakis et al. (1986) also assigned the PRNP locus to 20p by in situ hybridization.
Puckett, C.; Concannon, P.; Casey, C.; Hood, L. :
Genomic structure of the human prion protein gene. Am. J. Hum. Genet. 49:
320-329, 1991. MEDLINE UID : 91328137
Creutzfeld-Jacob disease and Gerstmann-Straussler syndrome are rare degenerative
disorders of the nervous system which have been genetically linked to the prion protein
(PrP) gene. The PrP gene encodes a host glycoprotein of unknown function and is located on
the short arm of chromosome 20, a region with few known genes or anonymous markers. The
complete structure of the PrP gene in man has not been determined despite considerable
interest in its relationship to these unusual disorders. We have determined that the human
PrP gene has the same simple genomic structure seen in the hamster gene and consists of two
exons and a single intron. In contrast to the hamster PrP gene the human gene appears to have
a single major transcriptional start site. The region immediately 5' of the transcriptional
start site of the human PrP gene demonstrates the GC-rich features commonly seen in
housekeeping genes. Curiously, the genomic clone we have isolated contains a 24-bp deletion
that removes one of five octameric peptide repeats predicted to form a B-pleated sheet in this
region of the PrP. We have also identified 5' of the PrP gene an RFLP [ Restriction Fragment Length Polymorphisms] which has a high degree
of heterozygosity and which should serve as a useful marker for the pter-12 region of human
chromosome 20.
Schnittger, S.; Gopal Rao, V. V. N.; Deutsch, U.; Gruss, P.; Balling, R.; Hansmann, I. :
PAX1, a member of the paired box-containing class of developmental
control genes, is mapped to human chromosome 20p11.2 by in situ
hybridization (ISH and FISH). Genomics 14: 740-744, 1992.
MEDLINE UID : 93052408
S. Schnittger, V. V. Rao, U. Deutsch, P. Gruss, R. Balling & I. Hansmann
Institut fur Humangenetik, Universitat Gottingen, Germany.
Pax-1, a member of a murine multigene family, belongs to the paired box-containing class of
developmental control genes first identified in Drosophila. The Pax-1 gene encodes a
sequence-specific DNA-binding protein with transcriptional activating properties and has
been found to be mutated in the autosomal recessive mutation undulated (un) on mouse
chromosome 2 with vertebral anomalies along the entire rostrocaudal axis. By radioactive in
situ hybridization (ISH) using a fragment from the murine Pax-1 paired box that is almost
identical to the respective sequences from the cognate human gene HuP48 and fluorescence in
situ hybridization (FISH) using a complete mouse Pax-1 cDNA, we have assigned the human
homologue of murine Pax-1, the PAX1 locus, to chromosome 20p. The map position of PAX1
after FISH (FL-pter value of 0.34 +/- 0.04) corresponds to band p11.2. These results
confirm the exceptional homology between human chromosome 20 and the distal segment of
mouse chromosome 2, extending from bands F to G, and add PAX1 to the group of genes on 20p
like PTPA, PRNP, SCG1, BMP2A, which are located in proximity on both chromosomes.
Burri et al. (1989) isolated and
sequenced 3 human genes that contained paired domains with strong homology to those in genes
in Drosophila involved in programming early development. One of these genes, called HuP48,
had a paired domain similar to that of the Drosophila gene P28 and nearly identical to that of
the Pax-1 gene of the mouse.
Transforming growth factor-beta (TGFB) superfamily encodes at least 12 members,
including TGFB1 (190180), TGFB2 (190220), TGFB3 (190230), Mullerian inhibitory
substance (600957), the bone morphogenetic proteins 2A, 2B, and 3, and the VG-1-related
gene product. Wozney et al. (1988) purified bone morphogenetic proteins BMP-2A and
BMP-3 from demineralized bone on the basis of their ability to induce the formation of
ectopic cartilage when implanted subcutaneously. Wang et al. (1990) showed that when
BMP-2A produced by recombinant DNA techniques was implanted into rats, bone formation
occurred by day 14.
Dickinson et al. (1990) demonstrated that in the mouse the Bmp-2a gene is located on chromosome 2 in a segment that shows homology of synteny with human 20p. They suggested, therefore, that the human BMP2A gene may be located on 20p. They pointed out that in the mouse 5 of the 8 loci (Tgfb-1, Bmp-2a, Bmp-2b1, Bmp-2b2, and Vgr-1) map near mutant loci associated with connective tissue and skeletal disorders, raising the possibility that at least some of these mutations result from defects in TGFB-related genes. The Bmp-2a gene is situated close to the tight skin (Tsk) locus (see 184900), raising the question that this gene may be the site for the mutation in 'tight skin.' Using cDNA probes for the analysis of somatic cell hybrid lines, Tabas et al. (1991) confirmed the assignment of BMP2A to chromosome 20. By both in situ hybridization and FISH, Gopal Rao et al. (1992) assigned BMP2A to 20p12.
Tabas et al. (1991) stated that 'BMP2A has been suggested as a reasonable candidate for the human condition fibrodysplasia (myositis) ossificans progressiva (FOP, 135100), on the basis of observations in a Drosophila model (Kaplan et al., 1990).'
REFERENCES
1. Benedum, U. M.; Lamouroux, A.; Konecki, D. S.; Rosa, P.; Hille, A.; Baeuerle, P. A.; Frank,
R.; Lottspeich, F.; Mallet, J.; Huttner, W. B. :
The primary structure of human secretogranin I (chromogranin B):
comparison with chromogranin A reveals homologous terminal domains
and a large intervening variable region. EMBO J. 6: 1203-1211, 1987.
MEDLINE UID : 87275810
From a human tumor cDNA library, Houssaint et al. (1990) isolated a gene encoding a putative receptor-like protein-tyrosine kinase that they called TK14. The amino acid sequence was closely related to that of the mouse protein bek (bacterially expressed kinase), and more distantly related to the sequences of a chicken basic fibroblast growth factor receptor (73% sequence homology) and its presumed human equivalent, the FLG protein (136350). Overexpression of the TK14 protein by transfection of COS-1 cells led to the appearance of new cell-surface binding sites for both acidic and basic fibroblast growth factors.
atggcgaaccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgcaagaagcgcccgaagcctggaggatggaacactgggggcagccgatacccgg ggcagggcagccctggaggcaaccgctacccacctcagggcggtggtggctgggggcagcctcatggtggtggctgggggcagcctcatggtggtggctgggggcagccccatggtg gtggctggggacagcctcatggtggtggctggggtcaaggaggtggcacccacagtcagtggaacaagccgagtaagccaaaaaccaacatgaagcacatggctggtgctgcagcag ctggggcagtggtggggggccttggcggctacatgctgggaagtgccatgagcaggcccatcatacatttcggcagtgactatgaggaccgttactatcgtgaaaacatgcaccgttac cccaaccaagtgtactacaggcccatggatgagtacagcaaccagaacaactttgtgcacgactgcgtcaatatcacaatcaagcagcacacggtcaccacaaccaccaagggggag aacttcaccgagaccgacgttaagatgatggagcgcgtggttgagcagatgtgtatcacccagtacgagagggaatctcaggcctattaccagagaggatcgagcatggtcctcttctc ctctccacctgtgatcctcctgatctctttcctcatcttcctgatagtgggatga
There are 8 known point variations in the prion gene for sheep. The frequency of these depends on breed and flock. The susceptibility to scrapie is influenced in a complex way by which alleles are present. Sheep and human amino acid sequences are easily aligned in the region of variant sheep alleles. None of the 8 known sheep alleles are known human variants (and vice versa for the 13 known human alleles).Only the R211Q variant in sheep would impact prion secondary structure (middle of helix H3), assuming the 3D NMR structure from mouse threads to the 3D sheep structure. This is in marked contrast to human CJD point mutation situation. Sheep, being highly inbred, could have fixed quite a few neutral alleles, more than in a wild species and that these wouldn't necessarily cause scrapie in and of themselves. However, the change from arginine to glutamine at codon 211 in the middle of a key structural alpha-helix has some chance of being causative.
On the one hand, it could be argued that this arginine would be solvent-exposed, that glutamine is very polar and so a fairly innocuous substitution; both residues are good helix-formers. CJD-causing mutations have tended to be in hydrophopic interior residues, one supposes disruptive of packing (and so conformation).
On the other hand, there has been a loss of positive charge and of 41 cubic angstroms in volume. This could affect not only conformation but also binding to other proteins. When the refined 3D structure appears, it would be worth taking a closer look at this arginine (as well as the other changes in sheep.) -- webmaster
| CODON | WT | V1 | V2 | V3 | V4 | V5 | V6 | V7 | V8 | human codon | variant | secondary structure | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 112 | M | T | - | - | - | - | - | - | - | 109M | none | none | |
| 136 | A | - | V | - | - | - | - | - | - | 133A | none | none | |
| 137 | M | - | - | T | - | - | - | - | - | 134M | none | none | |
| 141 | L | - | - | - | F | - | - | - | - | 138I | none | none | |
| 154 | R | - | - | - | - | H | - | - | - | 151R | none | none | |
| 171 | Q | - | - | - | - | - | H | R | - | 168E | none | none | |
| 211 | R | - | - | - | - | - | - | - | Q | 208R | none | alpha helix H3 |
| Color key: Beta sheet ... alpha helix | |||
| sheep | 96 | GG-SH SQWNK PSKPK TNM | 112 |
| human | 92 | GGGTH SQWNK PSKPK TNM | 109 |
| sheep | 113 | KHVAG AAAAG AVVGG LGGYM LGSAM SRPL | 141 |
| human | 110 | KHMAG AAAAG AVVGG LGGYM LGSAM SRPI | 138 |
| sheep | 142 | IHFGN DYEDR YYREN MYRYP NQVYY RPVDQ | 171 |
| human | 139 | IHFGS DYEDR YYREN MHRYP NQVYY RPMDE | 168 |
| sheep | 172 | YSNQN NFVHD CVNIT VKQHT VTTTT KGENF TETDI KIMER | 211 |
| human | 169 | YSNQN NFVHD CVNIT IKQHT VTTTT KGENF TETDV KMMER | 208 |
| sheep | 212 | VVEQM CITQY QRESQ AYYQR GAS | 234 |
| human | 209 | VVEQM CITQY ERESQ AYYQR GSS | 231 |
T. Ikeda, M. Horiuchi, N. Ishiguro, Y. Muramatsu, G. D. Kai-Uwe & M. Shinagawa J Gen Virol 76: 2577-2581 (1995)
We investigated the relationships between amino acid polymorphisms of the prion protein (PrP), restriction fragment length polymorphisms (RFLP) of the PrP gene and the incidence of natural scrapie in Japan. Six variant alleles of the PrP gene were found in healthy sheep. Based on the substitutions at codons 112, 136, 154 and 171, these allelic variants were designated, by amino acid at these codons, PrPMARQ, PrPTARQ, PrPMVRQ, PrPMAHQ, PrPMARR and PrPMARH. Each RFLP haplotype (e1h2, e1h2 or e3h1) consisted bo multiple alleles including PrPMARQ. Three of these variant alleles were found in scrapie-affected Suffolk sheep. PrPMARQ was associated with high disease incidence, PrPTARQ and PrPMARR were associated with low disease incidence. We found that one scrapie-affected Suffolk was homozygous for PrPMARR and four PrPSc-positive Suffolks carried PrPMVRQ. Both of two scrapie-affected Corriedales and two out of three scrapie-affected cross-breeds between Suffolk and Corriedale carried PrPMARH, suggesting that this allele associates with high incidence of scrapie in Corriedale and its cross-breeds.
Goldmann W; Hunter N; Martin T; Dawson M; Hope J AFRC Institute for Animal Health, Edinburgh, U.K. J Gen Virol 72 ( Pt 1): 201-4 (1991)Current models of the virus-like agents of scrapie and bovine spongiform encephalopathy (BSE) have to take into account that structural changes in a host-encoded protein (PrP protein) exhibit an effect on the time course of these diseases and the survival time of any man or animal exposed to these pathogens. We report here the sequence of different forms of the bovine PrP gene which contain either five or six copies of a short, G-C-rich element which encodes the octapeptide Pro-His-Gly-Gly-Gly-Trp-Gly-Gln or its longer variants Pro-Gln/His-Gly-Gly-Gly-Gly-Trp-Gly-Gln. Out of 12 cattle, we found eight animals homozygous for genes with six copies of the Gly-rich peptide (6:6), while four were heterozygous (6:5). Two confirmed cases of BSE occurred in (6:6) homozygous animals.
Hunter N; Goldmann W; Smith G; Hope J Institute for Animal Health, Neuropathogenesis Unit, Edinburgh. Vet Rec 135: 400-3 (1994)Bovine spongiform encephalopathy (BSE) is one of a family of scrapie-like diseases which affect various mammals. Polymorphisms and mutations of the PrP gene have been associated with the incidence of experimental and natural scrapie in other animals and this study of the bovine PrP gene was undertaken to discover whether there was a similar association with PrP genotype in cattle with BSE. There are two known polymorphisms of the coding region of the bovine PrP gene, a silent HindII restriction site polymorphism and a difference in the number of an octapeptide repeated sequence (either five or six copies). An analysis of 370 cattle in Scotland revealed no difference between the frequencies of these PrP genotypes in healthy cattle and cattle with BSE.