Signal peptide DNA alignment
Consensus Sequence: mammal, amrsupial, chicken
Pre-repeat DNA alignment

Prion DNA Alignment: Signal Peptide Region

atggcaaa      ccttagctactggctgctggcactctttgtggctacgtggactgatgttggcctctgc
atggcaaa      ccttggctgctggatgctagttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctactggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctactggctgctggccctctttgtgactacatgtactgatgttggcctctgc
atggcgaa      ccttggctactggctgctggccctctttgtgactatgtggactgatgtcggcctctgc
atggcgaa      ccttggctactggctgctggccctctttgtgactatgtggactgatgtcggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtaacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttgtctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttgtctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctgtttctctttgtggccacatggagtgacctgggcctctgc
atggcgaa      ccttggctgctggatgctggttctctttgtggccacatggagtgacctgggcctctgc   human
atggtgaaaagccacataggcagctggatcctagttctctttgtggccatgtggagtgacgtgggcctctgc
atggtgaaaagccacataggcagctggctcctggttctctttgtggccacatggagtgacattggcttctgc
atggtgaaaagccacataggcagttggatcctggtcctctttgtggccatgtggagtgacgtggccctctgc
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgacgtgggcctctgc
atggtgaaaagccacataggcagttggatcctggttctctttgtggccatgtggagtgacgtgggcctctgc
atggtgaaaagccatataggtggctggatcctcgttctctttgtggccgcatggagtgacatagggctctgc
----m---------mm-m--mm-m-----m-------------------mm---------m-m--m------   marsupial resolves
atggtgaaaagccacataggcagctggatcctggttctctttgtggccatgtggagtgacgtgggcctctgc   consensus eutherian
atgggaaaaatccaattgggatactggatcttggttctcttcattgttacctggagtgatctaggcctctgt   marsupial signal
----xx----x---xx-x--xxx-------x----------xx-x-xx-xx--------xx-x--------x   euth-marsup conflicts
----------t---ca----c-g-------c---------------cc-tg--------cg----------c   chicken resolves
atggtgaaaatccacataggcagctggatcctggttctctttgtggccatgtggagtgacgtgggcctctgc   consensus mammal
atggctaggctcctcaccacctgctgcctgctggccctgctgctcgccgcctgcaccgacgtcgccctctcc   chicken signal
----xx-xxx---x--xxxx-x----xx-x----xx--xx-xx-x---xxx--x-xx-----x-------x- 
   chic/euth-marsup conflicts

 M  V  K  S  H  I  G  S  W  I  L  V  L  F  V  A  M  W  S  D  V  G  L  C    consensus eutherian signal
 M  G  K  I  Q  L  G  Y  W  I  L  V  L  F  I  V  T  W  S  D  L  G  L  C    marsupial signal
 M  V  K  I  H  I  G  S  W  I  L  V  L  F  V  A  M  W  S  D  V  G  L  C    consensus mammal euth pref
 M  A  R  L  L  T  T  C  C  L  L  A  L  L  L  A  A  C  T  D  V  A  L  S    chicken signal

MVKSHIGSWILVLFVAMWSDVGLCK    consensus eutherian
MGKIQLGYWILVLFIVTWSDLGLCK    marsupial signal
MVKIHIGSWILVLFVAMWSDVGLCK    consensus mammal euth pref
MARLLTTCCLLALLLAACTDVALSK    chicken signal
oppp---p-popoppop-poo-opo    agreement, full,o and partial, p


Post-Signal, Pre-Repeat Prion DNA sequences

aagaagcgaccaaa-cctggagga-ggatggaacactggggggagccgatacccaggacagggcagtcctggaggcaaccgttatccacctcagggagggggt BTPRP aagaagcgaccaaaacctggagga-ggatggaacactggggggagccgatacccgggacagggaagtcctggaggcaaccgctatccacctcagggagggggt OHU25965 aagaagcgaccaaaacctggcgga-ggatggaacactggggggagccgatacccgggacagggcagtcctggaggcaaccgctatccacctcagggagggggt CHPRIPR aagaagcgaccaaagcctggcgga-ggatggaacactggggggagccgatacccagggcagggtagtcctggaggcaaccgctatccaccccagggagggggt PIGPRPG aagaagcggcccaagcctggagga-ggctggaacactggggggagccgatacccagggcagggcagtcctggaggcaaccgctacccaccccagggtggtggc MPU08952 aagaagcggccgaagcctggagga-ggatggaacacaggggggagccggtacccgggtcagagcagccctggaggcaaccgctacccaccccagggcgg----cggctg OCU28334 aaaaagcggccaaagcctggagggtggaac----accggtggaagccggtatcccgggcagggaagccctggaggcaaccgttacccacctcagggtgg----cacctg MUSPRPA aaaaagcggccaaagcctggagggtggaac----accggtggaagccggtatcccgggcagggaagccctggaggcaaccgttacccacctcagggtgg----cacctg MUSPRPB aaaaagcggccaaagcctggagggtggaac----actggtggaagccggtaccctgggcagggaagccctggaggcaaccgttacccacctcagagtggtggt S69654 aagaagcgcccaaaacctggaggatggaat----actgggggcagccgatacccaggccagggcagccctggaggcaacctctacccaccacagggtggtggc CAU08295 aagaagcgcccaaaacctggaggatggaat----actgggggcagccgatacccaggccagggcagtcctggaggcaaccgctacccaccacagggtggtggc CJU08304 aagaagcgcccaaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt MAU08311 aagaagcgcccaaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt MFU08298 aagaagcgcccaaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt MFU08301 aagaagcgcccaaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt MMU08307 aagaagcgcccaaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt MNU08306 aagaagcgcccaaagcctggaggatggaac----actgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggt PPU08305 aagaagcgcccgaaacctggaggatggaac----actgggggcagccgatacccaggccagggcagccctggaggcaaccgctacccaccccagggtggtggc APU15164 aagaagcgcccgaaacctggaggatggaat----actggggggagccgatacccaggccagggcagccctggaggcaaccgctacccaccccagggtggtggc SSU08310 aagaagcgcccgaagcccggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt CGU08297 aagaagcgcccgaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt CAU08291 aagaagcgcccgaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt CDU08292 aagaagcgcccgaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt MSU08303 aagaagcgcccgaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctacccaccccagggtggtggt PFU08302 aagaagcgcccgaagcctggaggatggaac----actggaggcagccgatacccggggcagggcagccctggaggcaaccgctatccaccccagggtggtggt PHU08294 aagaagcgcccgaagcctggaggatggaac----actgggggcagccgatacccggggcagggcagccctggaggcaaccgatacccacctcagggcggtggc HLU08299 aagaagcgcccgaagcctggaggatggaac----actgggggcagccgatacccggggcagggcagccctggaggcaaccgatacccacctcagggcggtggc SSU08308 aagaagcgcccgaagcctggaggatggaac----actgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggt GGU08300 aagaagcgcccgaagcctggaggatggaac----actgggggcagccgatacccggggcagggcagccctggaggcaaccgctacccacctcagggcggtggt PTU08296 aagaagcggccaaagcctggagggtggaac----actggtggaagccgataccctgggcagggcagccctggaggcaaccgttacccacctcagggtggtggc CRUPRPA K K R P K P G G G W N T G G S R Y P G Q G S P G G N R Y P P Q G G G K K R P K P G G W N T G G S R Y P G Q G S P G G N R Y P P Q G G G aagaagggcaaaggcaaacccagtggtgggggttggggcgccgggagccatcgccagcccagctacccccgccagccgggctaccctcataacccagggtacc CHKPRION K K G K G K P S G G G W G A G S H R Q P S Y P R Q P G Y P H N P G Y